ID: 1201175736

View in Genome Browser
Species Human (GRCh38)
Location Y:11307522-11307544
Sequence GGCTCATGAAAGCCCCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201175736_1201175743 16 Left 1201175736 Y:11307522-11307544 CCCACAAGGGGCTTTCATGAGCC No data
Right 1201175743 Y:11307561-11307583 CCCCGTGCTCCAGCCCAGCCAGG 0: 9
1: 10
2: 35
3: 72
4: 786

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201175736 Original CRISPR GGCTCATGAAAGCCCCTTGT GGG (reversed) Intergenic
No off target data available for this crispr