ID: 1201176996

View in Genome Browser
Species Human (GRCh38)
Location Y:11315526-11315548
Sequence GGCTCATGAAAGCCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201176996_1201177005 15 Left 1201176996 Y:11315526-11315548 CCCACAGGGGGCTTTCATGAGCC No data
Right 1201177005 Y:11315564-11315586 CCCCTGTACTGCAGCCCAGCCGG No data
1201176996_1201177007 16 Left 1201176996 Y:11315526-11315548 CCCACAGGGGGCTTTCATGAGCC No data
Right 1201177007 Y:11315565-11315587 CCCTGTACTGCAGCCCAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201176996 Original CRISPR GGCTCATGAAAGCCCCCTGT GGG (reversed) Intergenic
No off target data available for this crispr