ID: 1201181486

View in Genome Browser
Species Human (GRCh38)
Location Y:11351816-11351838
Sequence CTGCTTTTGGTGAAGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201181484_1201181486 24 Left 1201181484 Y:11351769-11351791 CCTAGAAACATTCAAGGGTCATT No data
Right 1201181486 Y:11351816-11351838 CTGCTTTTGGTGAAGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201181486 Original CRISPR CTGCTTTTGGTGAAGAAAAA AGG Intergenic
No off target data available for this crispr