ID: 1201183059 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:11368441-11368463 |
| Sequence | CAACATAAACATACAGAGCT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201183059_1201183061 | 9 | Left | 1201183059 | Y:11368441-11368463 | CCCAGCTCTGTATGTTTATGTTG | No data | ||
| Right | 1201183061 | Y:11368473-11368495 | AGAGCAACCAGTTGTTTATTAGG | No data | ||||
| 1201183059_1201183064 | 22 | Left | 1201183059 | Y:11368441-11368463 | CCCAGCTCTGTATGTTTATGTTG | No data | ||
| Right | 1201183064 | Y:11368486-11368508 | GTTTATTAGGATGGCCAAAAAGG | No data | ||||
| 1201183059_1201183062 | 13 | Left | 1201183059 | Y:11368441-11368463 | CCCAGCTCTGTATGTTTATGTTG | No data | ||
| Right | 1201183062 | Y:11368477-11368499 | CAACCAGTTGTTTATTAGGATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201183059 | Original CRISPR | CAACATAAACATACAGAGCT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||