ID: 1201183059

View in Genome Browser
Species Human (GRCh38)
Location Y:11368441-11368463
Sequence CAACATAAACATACAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201183059_1201183061 9 Left 1201183059 Y:11368441-11368463 CCCAGCTCTGTATGTTTATGTTG No data
Right 1201183061 Y:11368473-11368495 AGAGCAACCAGTTGTTTATTAGG No data
1201183059_1201183064 22 Left 1201183059 Y:11368441-11368463 CCCAGCTCTGTATGTTTATGTTG No data
Right 1201183064 Y:11368486-11368508 GTTTATTAGGATGGCCAAAAAGG No data
1201183059_1201183062 13 Left 1201183059 Y:11368441-11368463 CCCAGCTCTGTATGTTTATGTTG No data
Right 1201183062 Y:11368477-11368499 CAACCAGTTGTTTATTAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201183059 Original CRISPR CAACATAAACATACAGAGCT GGG (reversed) Intergenic
No off target data available for this crispr