ID: 1201188017

View in Genome Browser
Species Human (GRCh38)
Location Y:11422518-11422540
Sequence AAACATGAACAAATGGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201188011_1201188017 7 Left 1201188011 Y:11422488-11422510 CCCCTAGATAGAAGTGTGTGTAG No data
Right 1201188017 Y:11422518-11422540 AAACATGAACAAATGGAGCTGGG No data
1201188014_1201188017 5 Left 1201188014 Y:11422490-11422512 CCTAGATAGAAGTGTGTGTAGGA No data
Right 1201188017 Y:11422518-11422540 AAACATGAACAAATGGAGCTGGG No data
1201188009_1201188017 15 Left 1201188009 Y:11422480-11422502 CCCACTGACCCCTAGATAGAAGT No data
Right 1201188017 Y:11422518-11422540 AAACATGAACAAATGGAGCTGGG No data
1201188008_1201188017 28 Left 1201188008 Y:11422467-11422489 CCATGGAGTTGTTCCCACTGACC No data
Right 1201188017 Y:11422518-11422540 AAACATGAACAAATGGAGCTGGG No data
1201188010_1201188017 14 Left 1201188010 Y:11422481-11422503 CCACTGACCCCTAGATAGAAGTG No data
Right 1201188017 Y:11422518-11422540 AAACATGAACAAATGGAGCTGGG No data
1201188012_1201188017 6 Left 1201188012 Y:11422489-11422511 CCCTAGATAGAAGTGTGTGTAGG No data
Right 1201188017 Y:11422518-11422540 AAACATGAACAAATGGAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201188017 Original CRISPR AAACATGAACAAATGGAGCT GGG Intergenic
No off target data available for this crispr