ID: 1201189642

View in Genome Browser
Species Human (GRCh38)
Location Y:11436000-11436022
Sequence GGCTGCACTCCTTGGGGAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201189642_1201189659 16 Left 1201189642 Y:11436000-11436022 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 1201189659 Y:11436039-11436061 TTCCTGTGGAGTGGGGAGCTGGG No data
1201189642_1201189649 -7 Left 1201189642 Y:11436000-11436022 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 1201189649 Y:11436016-11436038 TGCAGCCCTGGTGGGCCCAATGG No data
1201189642_1201189655 8 Left 1201189642 Y:11436000-11436022 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 1201189655 Y:11436031-11436053 CCCAATGGTTCCTGTGGAGTGGG No data
1201189642_1201189652 2 Left 1201189642 Y:11436000-11436022 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 1201189652 Y:11436025-11436047 GGTGGGCCCAATGGTTCCTGTGG No data
1201189642_1201189657 9 Left 1201189642 Y:11436000-11436022 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 1201189657 Y:11436032-11436054 CCAATGGTTCCTGTGGAGTGGGG No data
1201189642_1201189658 15 Left 1201189642 Y:11436000-11436022 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 1201189658 Y:11436038-11436060 GTTCCTGTGGAGTGGGGAGCTGG No data
1201189642_1201189661 24 Left 1201189642 Y:11436000-11436022 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 1201189661 Y:11436047-11436069 GAGTGGGGAGCTGGGTGCTGTGG No data
1201189642_1201189653 7 Left 1201189642 Y:11436000-11436022 CCTGCTCCCCAAGGAGTGCAGCC No data
Right 1201189653 Y:11436030-11436052 GCCCAATGGTTCCTGTGGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201189642 Original CRISPR GGCTGCACTCCTTGGGGAGC AGG (reversed) Intergenic
No off target data available for this crispr