ID: 1201190992

View in Genome Browser
Species Human (GRCh38)
Location Y:11441452-11441474
Sequence GAAGATCCAGAGAAGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201190992_1201190999 16 Left 1201190992 Y:11441452-11441474 CCCTGCTCCTTCTCTGGATCTTC No data
Right 1201190999 Y:11441491-11441513 CCCTGGCCCTGCCCTTGTTCTGG No data
1201190992_1201190996 -1 Left 1201190992 Y:11441452-11441474 CCCTGCTCCTTCTCTGGATCTTC No data
Right 1201190996 Y:11441474-11441496 CTCTGGTTCTGCCTTCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201190992 Original CRISPR GAAGATCCAGAGAAGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr