ID: 1201193679

View in Genome Browser
Species Human (GRCh38)
Location Y:11471134-11471156
Sequence CCCCATGAGGTCATCAGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201193670_1201193679 18 Left 1201193670 Y:11471093-11471115 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 1201193679 Y:11471134-11471156 CCCCATGAGGTCATCAGTGCAGG No data
1201193674_1201193679 7 Left 1201193674 Y:11471104-11471126 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1201193679 Y:11471134-11471156 CCCCATGAGGTCATCAGTGCAGG No data
1201193676_1201193679 3 Left 1201193676 Y:11471108-11471130 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1201193679 Y:11471134-11471156 CCCCATGAGGTCATCAGTGCAGG No data
1201193672_1201193679 11 Left 1201193672 Y:11471100-11471122 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1201193679 Y:11471134-11471156 CCCCATGAGGTCATCAGTGCAGG No data
1201193669_1201193679 23 Left 1201193669 Y:11471088-11471110 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1201193679 Y:11471134-11471156 CCCCATGAGGTCATCAGTGCAGG No data
1201193673_1201193679 8 Left 1201193673 Y:11471103-11471125 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1201193679 Y:11471134-11471156 CCCCATGAGGTCATCAGTGCAGG No data
1201193671_1201193679 17 Left 1201193671 Y:11471094-11471116 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1201193679 Y:11471134-11471156 CCCCATGAGGTCATCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201193679 Original CRISPR CCCCATGAGGTCATCAGTGC AGG Intergenic
No off target data available for this crispr