ID: 1201193721

View in Genome Browser
Species Human (GRCh38)
Location Y:11471449-11471471
Sequence AGTTAACTGGAGAAGATGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201193718_1201193721 14 Left 1201193718 Y:11471412-11471434 CCAGTATAGGACAAGAGCTGTCT No data
Right 1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG No data
1201193714_1201193721 24 Left 1201193714 Y:11471402-11471424 CCCCAAAAGCCCAGTATAGGACA No data
Right 1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG No data
1201193717_1201193721 15 Left 1201193717 Y:11471411-11471433 CCCAGTATAGGACAAGAGCTGTC No data
Right 1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG No data
1201193716_1201193721 22 Left 1201193716 Y:11471404-11471426 CCAAAAGCCCAGTATAGGACAAG No data
Right 1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG No data
1201193715_1201193721 23 Left 1201193715 Y:11471403-11471425 CCCAAAAGCCCAGTATAGGACAA No data
Right 1201193721 Y:11471449-11471471 AGTTAACTGGAGAAGATGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201193721 Original CRISPR AGTTAACTGGAGAAGATGAC AGG Intergenic
No off target data available for this crispr