ID: 1201232216

View in Genome Browser
Species Human (GRCh38)
Location Y:11876142-11876164
Sequence GGCCATCTGGGAATTCCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201232209_1201232216 4 Left 1201232209 Y:11876115-11876137 CCACTTTTGGCTAACGTTTCTAG No data
Right 1201232216 Y:11876142-11876164 GGCCATCTGGGAATTCCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201232216 Original CRISPR GGCCATCTGGGAATTCCAGG GGG Intergenic
No off target data available for this crispr