ID: 1201235543

View in Genome Browser
Species Human (GRCh38)
Location Y:11907535-11907557
Sequence CACAGCTAACACCTTACTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201235539_1201235543 9 Left 1201235539 Y:11907503-11907525 CCAATATTTCACAATCATGTCAT No data
Right 1201235543 Y:11907535-11907557 CACAGCTAACACCTTACTTTGGG No data
1201235538_1201235543 18 Left 1201235538 Y:11907494-11907516 CCACAAGCTCCAATATTTCACAA No data
Right 1201235543 Y:11907535-11907557 CACAGCTAACACCTTACTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201235543 Original CRISPR CACAGCTAACACCTTACTTT GGG Intergenic
No off target data available for this crispr