ID: 1201237600

View in Genome Browser
Species Human (GRCh38)
Location Y:11926088-11926110
Sequence CTCAATGAAGGTTTCTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201237595_1201237600 1 Left 1201237595 Y:11926064-11926086 CCCCAGGTCAAACGCTCGGATTA No data
Right 1201237600 Y:11926088-11926110 CTCAATGAAGGTTTCTGGAATGG No data
1201237596_1201237600 0 Left 1201237596 Y:11926065-11926087 CCCAGGTCAAACGCTCGGATTAG No data
Right 1201237600 Y:11926088-11926110 CTCAATGAAGGTTTCTGGAATGG No data
1201237597_1201237600 -1 Left 1201237597 Y:11926066-11926088 CCAGGTCAAACGCTCGGATTAGC No data
Right 1201237600 Y:11926088-11926110 CTCAATGAAGGTTTCTGGAATGG No data
1201237593_1201237600 15 Left 1201237593 Y:11926050-11926072 CCAAAAATGCGCAGCCCCAGGTC No data
Right 1201237600 Y:11926088-11926110 CTCAATGAAGGTTTCTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201237600 Original CRISPR CTCAATGAAGGTTTCTGGAA TGG Intergenic