ID: 1201239501

View in Genome Browser
Species Human (GRCh38)
Location Y:11945090-11945112
Sequence GACTCCTGTCATTGCATTTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201239501_1201239507 23 Left 1201239501 Y:11945090-11945112 CCCTAAATGCAATGACAGGAGTC No data
Right 1201239507 Y:11945136-11945158 TGGTACACACAGAAAGGAGAAGG No data
1201239501_1201239505 3 Left 1201239501 Y:11945090-11945112 CCCTAAATGCAATGACAGGAGTC No data
Right 1201239505 Y:11945116-11945138 CTAAGAGACAAAAGAGGAGATGG No data
1201239501_1201239506 17 Left 1201239501 Y:11945090-11945112 CCCTAAATGCAATGACAGGAGTC No data
Right 1201239506 Y:11945130-11945152 AGGAGATGGTACACACAGAAAGG No data
1201239501_1201239503 -3 Left 1201239501 Y:11945090-11945112 CCCTAAATGCAATGACAGGAGTC No data
Right 1201239503 Y:11945110-11945132 GTCCTTCTAAGAGACAAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201239501 Original CRISPR GACTCCTGTCATTGCATTTA GGG (reversed) Intergenic
No off target data available for this crispr