ID: 1201239502

View in Genome Browser
Species Human (GRCh38)
Location Y:11945091-11945113
Sequence GGACTCCTGTCATTGCATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201239502_1201239506 16 Left 1201239502 Y:11945091-11945113 CCTAAATGCAATGACAGGAGTCC No data
Right 1201239506 Y:11945130-11945152 AGGAGATGGTACACACAGAAAGG No data
1201239502_1201239507 22 Left 1201239502 Y:11945091-11945113 CCTAAATGCAATGACAGGAGTCC No data
Right 1201239507 Y:11945136-11945158 TGGTACACACAGAAAGGAGAAGG No data
1201239502_1201239505 2 Left 1201239502 Y:11945091-11945113 CCTAAATGCAATGACAGGAGTCC No data
Right 1201239505 Y:11945116-11945138 CTAAGAGACAAAAGAGGAGATGG No data
1201239502_1201239503 -4 Left 1201239502 Y:11945091-11945113 CCTAAATGCAATGACAGGAGTCC No data
Right 1201239503 Y:11945110-11945132 GTCCTTCTAAGAGACAAAAGAGG No data
1201239502_1201239508 30 Left 1201239502 Y:11945091-11945113 CCTAAATGCAATGACAGGAGTCC No data
Right 1201239508 Y:11945144-11945166 ACAGAAAGGAGAAGGCCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201239502 Original CRISPR GGACTCCTGTCATTGCATTT AGG (reversed) Intergenic
No off target data available for this crispr