ID: 1201239504

View in Genome Browser
Species Human (GRCh38)
Location Y:11945112-11945134
Sequence CTCCTCTTTTGTCTCTTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201239504_1201239508 9 Left 1201239504 Y:11945112-11945134 CCTTCTAAGAGACAAAAGAGGAG No data
Right 1201239508 Y:11945144-11945166 ACAGAAAGGAGAAGGCCACATGG No data
1201239504_1201239507 1 Left 1201239504 Y:11945112-11945134 CCTTCTAAGAGACAAAAGAGGAG No data
Right 1201239507 Y:11945136-11945158 TGGTACACACAGAAAGGAGAAGG No data
1201239504_1201239506 -5 Left 1201239504 Y:11945112-11945134 CCTTCTAAGAGACAAAAGAGGAG No data
Right 1201239506 Y:11945130-11945152 AGGAGATGGTACACACAGAAAGG No data
1201239504_1201239509 18 Left 1201239504 Y:11945112-11945134 CCTTCTAAGAGACAAAAGAGGAG No data
Right 1201239509 Y:11945153-11945175 AGAAGGCCACATGGAGACAGAGG 0: 3
1: 25
2: 79
3: 257
4: 869
1201239504_1201239511 28 Left 1201239504 Y:11945112-11945134 CCTTCTAAGAGACAAAAGAGGAG No data
Right 1201239511 Y:11945163-11945185 ATGGAGACAGAGGCAGAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201239504 Original CRISPR CTCCTCTTTTGTCTCTTAGA AGG (reversed) Intergenic
No off target data available for this crispr