ID: 1201239507

View in Genome Browser
Species Human (GRCh38)
Location Y:11945136-11945158
Sequence TGGTACACACAGAAAGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201239501_1201239507 23 Left 1201239501 Y:11945090-11945112 CCCTAAATGCAATGACAGGAGTC No data
Right 1201239507 Y:11945136-11945158 TGGTACACACAGAAAGGAGAAGG No data
1201239504_1201239507 1 Left 1201239504 Y:11945112-11945134 CCTTCTAAGAGACAAAAGAGGAG No data
Right 1201239507 Y:11945136-11945158 TGGTACACACAGAAAGGAGAAGG No data
1201239502_1201239507 22 Left 1201239502 Y:11945091-11945113 CCTAAATGCAATGACAGGAGTCC No data
Right 1201239507 Y:11945136-11945158 TGGTACACACAGAAAGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201239507 Original CRISPR TGGTACACACAGAAAGGAGA AGG Intergenic
No off target data available for this crispr