ID: 1201240722

View in Genome Browser
Species Human (GRCh38)
Location Y:11954653-11954675
Sequence AGCTTCCTAGAAACGCCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201240722_1201240730 26 Left 1201240722 Y:11954653-11954675 CCATCCGGCGTTTCTAGGAAGCT No data
Right 1201240730 Y:11954702-11954724 ACTGTGCTCTTGCAATCGGTGGG No data
1201240722_1201240732 28 Left 1201240722 Y:11954653-11954675 CCATCCGGCGTTTCTAGGAAGCT No data
Right 1201240732 Y:11954704-11954726 TGTGCTCTTGCAATCGGTGGGGG No data
1201240722_1201240726 22 Left 1201240722 Y:11954653-11954675 CCATCCGGCGTTTCTAGGAAGCT No data
Right 1201240726 Y:11954698-11954720 GCCCACTGTGCTCTTGCAATCGG No data
1201240722_1201240731 27 Left 1201240722 Y:11954653-11954675 CCATCCGGCGTTTCTAGGAAGCT No data
Right 1201240731 Y:11954703-11954725 CTGTGCTCTTGCAATCGGTGGGG No data
1201240722_1201240729 25 Left 1201240722 Y:11954653-11954675 CCATCCGGCGTTTCTAGGAAGCT No data
Right 1201240729 Y:11954701-11954723 CACTGTGCTCTTGCAATCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201240722 Original CRISPR AGCTTCCTAGAAACGCCGGA TGG (reversed) Intergenic