ID: 1201244372

View in Genome Browser
Species Human (GRCh38)
Location Y:11988429-11988451
Sequence CTTGTCCATCTGGTCTAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201244368_1201244372 3 Left 1201244368 Y:11988403-11988425 CCCAGAAACTTCTCTGCAGTATC No data
Right 1201244372 Y:11988429-11988451 CTTGTCCATCTGGTCTAAGGTGG No data
1201244367_1201244372 12 Left 1201244367 Y:11988394-11988416 CCTGGAAAGCCCAGAAACTTCTC No data
Right 1201244372 Y:11988429-11988451 CTTGTCCATCTGGTCTAAGGTGG No data
1201244366_1201244372 13 Left 1201244366 Y:11988393-11988415 CCCTGGAAAGCCCAGAAACTTCT No data
Right 1201244372 Y:11988429-11988451 CTTGTCCATCTGGTCTAAGGTGG No data
1201244369_1201244372 2 Left 1201244369 Y:11988404-11988426 CCAGAAACTTCTCTGCAGTATCT No data
Right 1201244372 Y:11988429-11988451 CTTGTCCATCTGGTCTAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201244372 Original CRISPR CTTGTCCATCTGGTCTAAGG TGG Intergenic
No off target data available for this crispr