ID: 1201245150

View in Genome Browser
Species Human (GRCh38)
Location Y:11996213-11996235
Sequence ACCAAAAATGTCTCTAGATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201245143_1201245150 15 Left 1201245143 Y:11996175-11996197 CCACAAGATGCCAGGAGCACGCA No data
Right 1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG No data
1201245144_1201245150 5 Left 1201245144 Y:11996185-11996207 CCAGGAGCACGCACCACCCCAGT No data
Right 1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG No data
1201245141_1201245150 19 Left 1201245141 Y:11996171-11996193 CCACCCACAAGATGCCAGGAGCA No data
Right 1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG No data
1201245139_1201245150 27 Left 1201245139 Y:11996163-11996185 CCTGGGCTCCACCCACAAGATGC No data
Right 1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG No data
1201245142_1201245150 16 Left 1201245142 Y:11996174-11996196 CCCACAAGATGCCAGGAGCACGC No data
Right 1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG No data
1201245138_1201245150 28 Left 1201245138 Y:11996162-11996184 CCCTGGGCTCCACCCACAAGATG No data
Right 1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG No data
1201245146_1201245150 -8 Left 1201245146 Y:11996198-11996220 CCACCCCAGTGGACAACCAAAAA No data
Right 1201245150 Y:11996213-11996235 ACCAAAAATGTCTCTAGATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201245150 Original CRISPR ACCAAAAATGTCTCTAGATA TGG Intergenic
No off target data available for this crispr