ID: 1201245953

View in Genome Browser
Species Human (GRCh38)
Location Y:12003925-12003947
Sequence AATTAAATGGTGACAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201245953_1201245959 16 Left 1201245953 Y:12003925-12003947 CCATCCATTGTCACCATTTAATT No data
Right 1201245959 Y:12003964-12003986 AGAAAAACAAAACTTCAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201245953 Original CRISPR AATTAAATGGTGACAATGGA TGG (reversed) Intergenic
No off target data available for this crispr