ID: 1201249064 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | Y:12037591-12037613 |
| Sequence | TCTGATCCTAAAATAGAAGA CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1201249062_1201249064 | 22 | Left | 1201249062 | Y:12037546-12037568 | CCTATACGTGCAATTTATCTATT | No data | ||
| Right | 1201249064 | Y:12037591-12037613 | TCTGATCCTAAAATAGAAGACGG | No data | ||||
| 1201249063_1201249064 | -8 | Left | 1201249063 | Y:12037576-12037598 | CCTGTACATGAACTCTCTGATCC | No data | ||
| Right | 1201249064 | Y:12037591-12037613 | TCTGATCCTAAAATAGAAGACGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1201249064 | Original CRISPR | TCTGATCCTAAAATAGAAGA CGG | Intergenic | ||
| No off target data available for this crispr | |||||