ID: 1201249064

View in Genome Browser
Species Human (GRCh38)
Location Y:12037591-12037613
Sequence TCTGATCCTAAAATAGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201249062_1201249064 22 Left 1201249062 Y:12037546-12037568 CCTATACGTGCAATTTATCTATT No data
Right 1201249064 Y:12037591-12037613 TCTGATCCTAAAATAGAAGACGG No data
1201249063_1201249064 -8 Left 1201249063 Y:12037576-12037598 CCTGTACATGAACTCTCTGATCC No data
Right 1201249064 Y:12037591-12037613 TCTGATCCTAAAATAGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201249064 Original CRISPR TCTGATCCTAAAATAGAAGA CGG Intergenic
No off target data available for this crispr