ID: 1201251268

View in Genome Browser
Species Human (GRCh38)
Location Y:12060491-12060513
Sequence TTGGCAGGGTGTATGTGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 16951
Summary {0: 25, 1: 2750, 2: 4665, 3: 5983, 4: 3528}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201251268_1201251274 23 Left 1201251268 Y:12060491-12060513 CCTGGACACATACACCCTGCCAA 0: 25
1: 2750
2: 4665
3: 5983
4: 3528
Right 1201251274 Y:12060537-12060559 TATCTGAACAGATCAATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201251268 Original CRISPR TTGGCAGGGTGTATGTGTCC AGG (reversed) Intergenic
Too many off-targets to display for this crispr