ID: 1201251270

View in Genome Browser
Species Human (GRCh38)
Location Y:12060505-12060527
Sequence TTCCTGGTTTAGTATTGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201251270_1201251275 23 Left 1201251270 Y:12060505-12060527 CCCTGCCAATACTAAACCAGGAA No data
Right 1201251275 Y:12060551-12060573 AATAGCAGGCTCTGAAATTGAGG 0: 68
1: 4307
2: 3735
3: 4133
4: 2042
1201251270_1201251274 9 Left 1201251270 Y:12060505-12060527 CCCTGCCAATACTAAACCAGGAA No data
Right 1201251274 Y:12060537-12060559 TATCTGAACAGATCAATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201251270 Original CRISPR TTCCTGGTTTAGTATTGGCA GGG (reversed) Intergenic
No off target data available for this crispr