ID: 1201251273

View in Genome Browser
Species Human (GRCh38)
Location Y:12060521-12060543
Sequence TCAGATATTCAACTTCTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14563
Summary {0: 43, 1: 5910, 2: 3595, 3: 2439, 4: 2576}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201251273_1201251274 -7 Left 1201251273 Y:12060521-12060543 CCAGGAAGAAGTTGAATATCTGA 0: 43
1: 5910
2: 3595
3: 2439
4: 2576
Right 1201251274 Y:12060537-12060559 TATCTGAACAGATCAATAGCAGG No data
1201251273_1201251275 7 Left 1201251273 Y:12060521-12060543 CCAGGAAGAAGTTGAATATCTGA 0: 43
1: 5910
2: 3595
3: 2439
4: 2576
Right 1201251275 Y:12060551-12060573 AATAGCAGGCTCTGAAATTGAGG 0: 68
1: 4307
2: 3735
3: 4133
4: 2042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201251273 Original CRISPR TCAGATATTCAACTTCTTCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr