ID: 1201251274

View in Genome Browser
Species Human (GRCh38)
Location Y:12060537-12060559
Sequence TATCTGAACAGATCAATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201251270_1201251274 9 Left 1201251270 Y:12060505-12060527 CCCTGCCAATACTAAACCAGGAA No data
Right 1201251274 Y:12060537-12060559 TATCTGAACAGATCAATAGCAGG No data
1201251271_1201251274 8 Left 1201251271 Y:12060506-12060528 CCTGCCAATACTAAACCAGGAAG No data
Right 1201251274 Y:12060537-12060559 TATCTGAACAGATCAATAGCAGG No data
1201251268_1201251274 23 Left 1201251268 Y:12060491-12060513 CCTGGACACATACACCCTGCCAA 0: 25
1: 2750
2: 4665
3: 5983
4: 3528
Right 1201251274 Y:12060537-12060559 TATCTGAACAGATCAATAGCAGG No data
1201251273_1201251274 -7 Left 1201251273 Y:12060521-12060543 CCAGGAAGAAGTTGAATATCTGA 0: 43
1: 5910
2: 3595
3: 2439
4: 2576
Right 1201251274 Y:12060537-12060559 TATCTGAACAGATCAATAGCAGG No data
1201251272_1201251274 4 Left 1201251272 Y:12060510-12060532 CCAATACTAAACCAGGAAGAAGT 0: 38
1: 8084
2: 3969
3: 2105
4: 2282
Right 1201251274 Y:12060537-12060559 TATCTGAACAGATCAATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201251274 Original CRISPR TATCTGAACAGATCAATAGC AGG Intergenic
No off target data available for this crispr