ID: 1201251275

View in Genome Browser
Species Human (GRCh38)
Location Y:12060551-12060573
Sequence AATAGCAGGCTCTGAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 14285
Summary {0: 68, 1: 4307, 2: 3735, 3: 4133, 4: 2042}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201251271_1201251275 22 Left 1201251271 Y:12060506-12060528 CCTGCCAATACTAAACCAGGAAG No data
Right 1201251275 Y:12060551-12060573 AATAGCAGGCTCTGAAATTGAGG 0: 68
1: 4307
2: 3735
3: 4133
4: 2042
1201251272_1201251275 18 Left 1201251272 Y:12060510-12060532 CCAATACTAAACCAGGAAGAAGT 0: 38
1: 8084
2: 3969
3: 2105
4: 2282
Right 1201251275 Y:12060551-12060573 AATAGCAGGCTCTGAAATTGAGG 0: 68
1: 4307
2: 3735
3: 4133
4: 2042
1201251270_1201251275 23 Left 1201251270 Y:12060505-12060527 CCCTGCCAATACTAAACCAGGAA No data
Right 1201251275 Y:12060551-12060573 AATAGCAGGCTCTGAAATTGAGG 0: 68
1: 4307
2: 3735
3: 4133
4: 2042
1201251273_1201251275 7 Left 1201251273 Y:12060521-12060543 CCAGGAAGAAGTTGAATATCTGA 0: 43
1: 5910
2: 3595
3: 2439
4: 2576
Right 1201251275 Y:12060551-12060573 AATAGCAGGCTCTGAAATTGAGG 0: 68
1: 4307
2: 3735
3: 4133
4: 2042

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201251275 Original CRISPR AATAGCAGGCTCTGAAATTG AGG Intergenic
Too many off-targets to display for this crispr