ID: 1201254873

View in Genome Browser
Species Human (GRCh38)
Location Y:12097407-12097429
Sequence GGCTGAAATCATGTGTTGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201254873_1201254880 9 Left 1201254873 Y:12097407-12097429 CCTGACAACACATGATTTCAGCC No data
Right 1201254880 Y:12097439-12097461 CCTCAGTAGAGAACTCAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201254873 Original CRISPR GGCTGAAATCATGTGTTGTC AGG (reversed) Intergenic
No off target data available for this crispr