ID: 1201261066

View in Genome Browser
Species Human (GRCh38)
Location Y:12159321-12159343
Sequence TGTGTTCTTCGGATCTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201261055_1201261066 25 Left 1201261055 Y:12159273-12159295 CCTCTCTAAAATGTATAAAACCA 0: 49
1: 189
2: 282
3: 233
4: 425
Right 1201261066 Y:12159321-12159343 TGTGTTCTTCGGATCTCCTGGGG No data
1201261060_1201261066 -5 Left 1201261060 Y:12159303-12159325 CCCTGACCGCTTTGGGCATGTGT No data
Right 1201261066 Y:12159321-12159343 TGTGTTCTTCGGATCTCCTGGGG No data
1201261061_1201261066 -6 Left 1201261061 Y:12159304-12159326 CCTGACCGCTTTGGGCATGTGTT No data
Right 1201261066 Y:12159321-12159343 TGTGTTCTTCGGATCTCCTGGGG No data
1201261057_1201261066 5 Left 1201261057 Y:12159293-12159315 CCAAGGTATACCCTGACCGCTTT No data
Right 1201261066 Y:12159321-12159343 TGTGTTCTTCGGATCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201261066 Original CRISPR TGTGTTCTTCGGATCTCCTG GGG Intergenic
No off target data available for this crispr