ID: 1201264246

View in Genome Browser
Species Human (GRCh38)
Location Y:12190779-12190801
Sequence TCTTATGTGCAGGAAGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201264246_1201264251 -9 Left 1201264246 Y:12190779-12190801 CCTGCCCCTTCCTGCACATAAGA No data
Right 1201264251 Y:12190793-12190815 CACATAAGATAATGTCTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201264246 Original CRISPR TCTTATGTGCAGGAAGGGGC AGG (reversed) Intergenic
No off target data available for this crispr