ID: 1201264666

View in Genome Browser
Species Human (GRCh38)
Location Y:12194189-12194211
Sequence TCCAATCCCCAGTGTGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201264658_1201264666 28 Left 1201264658 Y:12194138-12194160 CCGGTTTTTCAGGTGAAAGTGGT No data
Right 1201264666 Y:12194189-12194211 TCCAATCCCCAGTGTGGAAGGGG No data
1201264660_1201264666 0 Left 1201264660 Y:12194166-12194188 CCATATATAGTATATTCCCTGGT No data
Right 1201264666 Y:12194189-12194211 TCCAATCCCCAGTGTGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201264666 Original CRISPR TCCAATCCCCAGTGTGGAAG GGG Intergenic
No off target data available for this crispr