ID: 1201264905

View in Genome Browser
Species Human (GRCh38)
Location Y:12196680-12196702
Sequence TCTGTATGCTGAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201264905_1201264908 8 Left 1201264905 Y:12196680-12196702 CCAGCACTCCCTCAGCATACAGA No data
Right 1201264908 Y:12196711-12196733 ACAAATTTTCCTTTGTTTTATGG 0: 26
1: 17
2: 18
3: 83
4: 931

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201264905 Original CRISPR TCTGTATGCTGAGGGAGTGC TGG (reversed) Intergenic
No off target data available for this crispr