ID: 1201267114

View in Genome Browser
Species Human (GRCh38)
Location Y:12217943-12217965
Sequence CAGTAAGTGCATCCTGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201267114_1201267116 -6 Left 1201267114 Y:12217943-12217965 CCCTGTGCAGGATGCACTTACTG No data
Right 1201267116 Y:12217960-12217982 TTACTGTTCATCTCCTGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201267114 Original CRISPR CAGTAAGTGCATCCTGCACA GGG (reversed) Intergenic
No off target data available for this crispr