ID: 1201271820

View in Genome Browser
Species Human (GRCh38)
Location Y:12263221-12263243
Sequence TGGGTCTTCCCCCAGAGGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201271815_1201271820 1 Left 1201271815 Y:12263197-12263219 CCATGATTGCCTTGTGATACTTA No data
Right 1201271820 Y:12263221-12263243 TGGGTCTTCCCCCAGAGGTTAGG No data
1201271818_1201271820 -8 Left 1201271818 Y:12263206-12263228 CCTTGTGATACTTAATGGGTCTT No data
Right 1201271820 Y:12263221-12263243 TGGGTCTTCCCCCAGAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201271820 Original CRISPR TGGGTCTTCCCCCAGAGGTT AGG Intergenic
No off target data available for this crispr