ID: 1201272432

View in Genome Browser
Species Human (GRCh38)
Location Y:12268026-12268048
Sequence GAAAAATTGTAGGCCGGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201272432_1201272437 12 Left 1201272432 Y:12268026-12268048 CCGCACCCGGCCTACAATTTTTC No data
Right 1201272437 Y:12268061-12268083 GAAGATTAAGAATGTTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201272432 Original CRISPR GAAAAATTGTAGGCCGGGTG CGG (reversed) Intergenic
No off target data available for this crispr