ID: 1201274969

View in Genome Browser
Species Human (GRCh38)
Location Y:12288042-12288064
Sequence CTTTTGCCCTGGGGGATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201274957_1201274969 28 Left 1201274957 Y:12287991-12288013 CCTGTAACTGTCTGCACAGTTAC No data
Right 1201274969 Y:12288042-12288064 CTTTTGCCCTGGGGGATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201274969 Original CRISPR CTTTTGCCCTGGGGGATCTG TGG Intergenic
No off target data available for this crispr