ID: 1201277536

View in Genome Browser
Species Human (GRCh38)
Location Y:12312979-12313001
Sequence GGCATGGGCTATGTGCTCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201277528_1201277536 15 Left 1201277528 Y:12312941-12312963 CCAATGTGGGGAGTAACGTGGGG No data
Right 1201277536 Y:12312979-12313001 GGCATGGGCTATGTGCTCCGAGG No data
1201277525_1201277536 24 Left 1201277525 Y:12312932-12312954 CCATAGAGGCCAATGTGGGGAGT No data
Right 1201277536 Y:12312979-12313001 GGCATGGGCTATGTGCTCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201277536 Original CRISPR GGCATGGGCTATGTGCTCCG AGG Intergenic
No off target data available for this crispr