ID: 1201280302

View in Genome Browser
Species Human (GRCh38)
Location Y:12336575-12336597
Sequence CACGTCAACCCAGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201280295_1201280302 17 Left 1201280295 Y:12336535-12336557 CCTGTAATCTCAGCTACTCGAAA No data
Right 1201280302 Y:12336575-12336597 CACGTCAACCCAGGAGGCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201280302 Original CRISPR CACGTCAACCCAGGAGGCGG AGG Intergenic
No off target data available for this crispr