ID: 1201291027

View in Genome Browser
Species Human (GRCh38)
Location Y:12421044-12421066
Sequence TGCAGGGCGTGGAGGGGATT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201291027_1201291041 17 Left 1201291027 Y:12421044-12421066 CCGAATCCCCTCCACGCCCTGCA No data
Right 1201291041 Y:12421084-12421106 GCTCCCGCAGCCTCTGCCTTGGG 0: 2
1: 0
2: 5
3: 33
4: 325
1201291027_1201291040 16 Left 1201291027 Y:12421044-12421066 CCGAATCCCCTCCACGCCCTGCA No data
Right 1201291040 Y:12421083-12421105 CGCTCCCGCAGCCTCTGCCTTGG 0: 2
1: 1
2: 4
3: 29
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201291027 Original CRISPR TGCAGGGCGTGGAGGGGATT CGG (reversed) Intergenic
No off target data available for this crispr