ID: 1201291209

View in Genome Browser
Species Human (GRCh38)
Location Y:12421643-12421665
Sequence CGCCCAGCCCTGGTAGGCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201291198_1201291209 -2 Left 1201291198 Y:12421622-12421644 CCTGAAGCCCGGCCCCGCCTCCG No data
Right 1201291209 Y:12421643-12421665 CGCCCAGCCCTGGTAGGCGCGGG No data
1201291200_1201291209 -10 Left 1201291200 Y:12421630-12421652 CCGGCCCCGCCTCCGCCCAGCCC No data
Right 1201291209 Y:12421643-12421665 CGCCCAGCCCTGGTAGGCGCGGG No data
1201291199_1201291209 -9 Left 1201291199 Y:12421629-12421651 CCCGGCCCCGCCTCCGCCCAGCC No data
Right 1201291209 Y:12421643-12421665 CGCCCAGCCCTGGTAGGCGCGGG No data
1201291195_1201291209 23 Left 1201291195 Y:12421597-12421619 CCGGAGGGCAGCGATTGGCCTCT No data
Right 1201291209 Y:12421643-12421665 CGCCCAGCCCTGGTAGGCGCGGG No data
1201291197_1201291209 5 Left 1201291197 Y:12421615-12421637 CCTCTGTCCTGAAGCCCGGCCCC No data
Right 1201291209 Y:12421643-12421665 CGCCCAGCCCTGGTAGGCGCGGG No data
1201291194_1201291209 24 Left 1201291194 Y:12421596-12421618 CCCGGAGGGCAGCGATTGGCCTC No data
Right 1201291209 Y:12421643-12421665 CGCCCAGCCCTGGTAGGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201291209 Original CRISPR CGCCCAGCCCTGGTAGGCGC GGG Intergenic
No off target data available for this crispr