ID: 1201292869

View in Genome Browser
Species Human (GRCh38)
Location Y:12438951-12438973
Sequence GTCCCCGAAGGAAACCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 2, 1: 0, 2: 1, 3: 9, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201292869_1201292872 0 Left 1201292869 Y:12438951-12438973 CCTTTCTGGTTTCCTTCGGGGAC 0: 2
1: 0
2: 1
3: 9
4: 115
Right 1201292872 Y:12438974-12438996 ACAAAGAAGGTATGAGTTAGAGG 0: 2
1: 0
2: 1
3: 11
4: 281
1201292869_1201292874 7 Left 1201292869 Y:12438951-12438973 CCTTTCTGGTTTCCTTCGGGGAC 0: 2
1: 0
2: 1
3: 9
4: 115
Right 1201292874 Y:12438981-12439003 AGGTATGAGTTAGAGGGCCCTGG 0: 2
1: 0
2: 1
3: 4
4: 158
1201292869_1201292873 1 Left 1201292869 Y:12438951-12438973 CCTTTCTGGTTTCCTTCGGGGAC 0: 2
1: 0
2: 1
3: 9
4: 115
Right 1201292873 Y:12438975-12438997 CAAAGAAGGTATGAGTTAGAGGG 0: 2
1: 0
2: 0
3: 19
4: 223
1201292869_1201292875 8 Left 1201292869 Y:12438951-12438973 CCTTTCTGGTTTCCTTCGGGGAC 0: 2
1: 0
2: 1
3: 9
4: 115
Right 1201292875 Y:12438982-12439004 GGTATGAGTTAGAGGGCCCTGGG 0: 2
1: 0
2: 1
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201292869 Original CRISPR GTCCCCGAAGGAAACCAGAA AGG (reversed) Intergenic
901283943 1:8061400-8061422 GTCACTGAAGGAAAGCAGACAGG - Intergenic
903312472 1:22470456-22470478 GGCCCAGAAGGAAGCTAGAAGGG + Intronic
903356949 1:22754190-22754212 GTCCCCAAACCAAACCAAAATGG + Intronic
903660222 1:24972587-24972609 GTCCCTCAAGGAAAGCAGCAGGG - Intergenic
907440560 1:54475740-54475762 GTCACTGATGGAGACCAGAAGGG - Intergenic
909751416 1:79165872-79165894 GTCCCTGAAGGCAGCCAGGAGGG + Intergenic
910803911 1:91171612-91171634 GTCCTCGATGGACCCCAGAAGGG - Intergenic
915070844 1:153264835-153264857 GTCCCAGAAGGAGAGGAGAAAGG + Intergenic
915690893 1:157689793-157689815 GGGCCCGAAGGAAACCAGGTGGG - Exonic
920433208 1:205932078-205932100 CACACCGATGGAAACCAGAAAGG + Intronic
921248106 1:213267973-213267995 GTCCCAGAAGGAGAGGAGAAAGG + Intronic
922311068 1:224391527-224391549 GTCTCTGAAGGAAACAAAAAAGG - Intronic
923620730 1:235577192-235577214 GTACCAGCAGGAAACCAAAAGGG - Intronic
1069884489 10:71615285-71615307 GTCCCAGAAGGAGAACAGCATGG - Intronic
1072613617 10:97035279-97035301 GTCCCCGAGGGCACCCAGATTGG - Intronic
1072828028 10:98628270-98628292 GTCCAGGAAGGAAATCAGCATGG + Intronic
1083416699 11:62530494-62530516 GGCCCGGAAGGAAAGCTGAAGGG - Exonic
1083651886 11:64208837-64208859 GGCCCCGAAGGCCTCCAGAAGGG + Intronic
1084136415 11:67186041-67186063 GTACCAGAAGGAAAATAGAAAGG + Intronic
1084738904 11:71125349-71125371 GTTCCTGAAGGAAATTAGAAGGG + Intronic
1087818513 11:102685595-102685617 GGCCCTTAAGAAAACCAGAAGGG + Intergenic
1091986344 12:4912201-4912223 GAGCAGGAAGGAAACCAGAAGGG + Exonic
1095829363 12:46568191-46568213 GTTCCAGAAGGAAAAGAGAAGGG - Intergenic
1096487644 12:51994484-51994506 GTCCCCGAAGGAAACCCTCAGGG - Intronic
1098739692 12:74156857-74156879 GTCCAAGAAGGAAACAAAAAAGG - Intergenic
1100985302 12:100197894-100197916 TTCCCCGAAGGAAGCCAGCCAGG - Intergenic
1108080200 13:46727429-46727451 GGCCCAGAAGGAAAGGAGAATGG + Intronic
1112847763 13:103665180-103665202 GTCCACAAAGGAAAACAAAATGG + Intergenic
1113944499 13:114036293-114036315 GTTCCAGAAGGAAGCAAGAAAGG + Intronic
1117252254 14:53949688-53949710 GAGCCCGAAGGAAAAGAGAAAGG + Intergenic
1122096421 14:99376388-99376410 GACCCTGAAAGAAACAAGAAAGG + Intergenic
1126525026 15:49644369-49644391 GTCAGCGAAGGAAAGCAGAGTGG + Exonic
1129487931 15:75894590-75894612 GAACCTGAAGGAAAGCAGAATGG + Intronic
1131795438 15:96011217-96011239 GTTTCCCAAGGAAATCAGAATGG + Intergenic
1131815572 15:96217861-96217883 GAACCAGAAGGAAACCTGAAGGG + Intergenic
1134456909 16:14401665-14401687 GTCCCCAGTGCAAACCAGAAGGG - Intergenic
1135168133 16:20158369-20158391 GACTCCCAAGGAAACCAGGAGGG - Intergenic
1136283746 16:29229621-29229643 CTCCTCGTAGGAAACCAGCAGGG - Intergenic
1136517713 16:30777869-30777891 GTCCGTGAAGGAAACCAGAATGG - Intergenic
1139329174 16:66174336-66174358 GAGCCAGAAGGAAACCAGAGGGG + Intergenic
1139961591 16:70721216-70721238 GGCCTAGAAGGAAGCCAGAAAGG + Intronic
1141057818 16:80834841-80834863 GTCTCCAAAGGAAACCAGTGTGG + Intergenic
1142088778 16:88199132-88199154 CTCCTCGTAGGAAACCAGCAGGG - Intergenic
1142735724 17:1897851-1897873 GTCCCCTAAGGAAATCCGAGCGG + Exonic
1143301316 17:5912597-5912619 GGCACAGAAGGAACCCAGAAGGG + Intronic
1143598369 17:7929146-7929168 GTCCCGAAAGGAAAGCGGAAGGG + Intronic
1151397125 17:73830655-73830677 GTGCCAAAAAGAAACCAGAAAGG - Intergenic
1151569786 17:74920569-74920591 GGCTCCGAAGGACACCAGGAAGG + Exonic
1155303797 18:24458852-24458874 GTCCCAGGAGGAAAGGAGAAAGG - Intergenic
1157095695 18:44683672-44683694 GTCTCCACAGGAACCCAGAAAGG - Intronic
1159092959 18:63870250-63870272 GCCCCCAGAAGAAACCAGAAAGG + Intergenic
1164859554 19:31552090-31552112 GTCTCCGAAGGAGCCCAAAAAGG - Intergenic
1167159338 19:47756903-47756925 GTCCCCAAAGGGAAACTGAAAGG + Intronic
925422500 2:3724426-3724448 GTCCCTGAAGGAGACCAGGGAGG - Intronic
928786925 2:34899173-34899195 TTCCCTGAAGAAAAACAGAATGG + Intergenic
929236172 2:39607699-39607721 GTCCCTAAAGGAAAGCAGCATGG - Intergenic
933674425 2:85041410-85041432 TTCCTAGAAGGAAAACAGAATGG - Intronic
935669909 2:105546317-105546339 CTCCCCAAAGCAAAGCAGAAAGG + Intergenic
937050686 2:118886073-118886095 GACCCTGAGGGTAACCAGAATGG - Intergenic
940391771 2:153140782-153140804 TTCACCGAAAGAAAACAGAAAGG + Intergenic
945912695 2:215667831-215667853 TTCCCCGAAAGGAAACAGAAGGG + Intergenic
945929950 2:215844741-215844763 TTCCCGAAGGGAAACCAGAAGGG - Intergenic
946193818 2:218021749-218021771 GTCCCCCAAGGAGACCAGGAGGG + Intergenic
1170767370 20:19301759-19301781 GGCCCAGAAGGTAACTAGAAGGG - Intronic
1172790822 20:37504289-37504311 GTCCTCTAAGGAGTCCAGAAGGG - Intronic
1174609089 20:51784415-51784437 GGCCCCCAAGGAAACCGGGAGGG + Exonic
1180353467 22:11822003-11822025 GTACCCCAAGGAAGACAGAAGGG - Intergenic
1180384774 22:12170354-12170376 GTACCCCAAGGAAGACAGAAGGG + Intergenic
1183234367 22:36606246-36606268 GACCCAGAATGAAACCACAAGGG + Intronic
1184713210 22:46265291-46265313 GCCCACGAAGGCAACCAGGAGGG - Intergenic
1185209875 22:49564821-49564843 GTCCCCGAGTGAAACAAGAAAGG - Intronic
1185231664 22:49687392-49687414 GTCCCCCAAGGAAAGCAGGCAGG + Intergenic
949311370 3:2702255-2702277 GCCACCAAAGGAAACCAGAGTGG + Intronic
954426153 3:50444144-50444166 GTCCCCCAAGGACTCCAGAGTGG + Intronic
955859327 3:63310820-63310842 TTCCCAGAAAGAAATCAGAAAGG + Intronic
959905675 3:111708714-111708736 ATCCCTGAGGGGAACCAGAAGGG - Intronic
961558942 3:127715646-127715668 GTGCATGAAGGAAAGCAGAACGG + Intronic
962304792 3:134276295-134276317 GTTCCCAAATGAAACCAGAAGGG + Intergenic
962979613 3:140476053-140476075 ATCCCCAAAGGAAACGAGAAAGG - Intronic
966330162 3:178803088-178803110 GTCTCCCAAGCAACCCAGAAAGG + Intronic
969261192 4:6035161-6035183 GTCACAGAAGGAAAAAAGAAGGG - Intronic
969432628 4:7164815-7164837 GTCCCAGGAGAAAACCAGGAAGG - Intergenic
975325684 4:73056387-73056409 GTCAAAGAAGAAAACCAGAAGGG - Exonic
980172878 4:129311339-129311361 ATCACCGAAAGAAACCATAAGGG - Intergenic
982434492 4:155368049-155368071 TTCCCTGATGGAAACCTGAAAGG + Intronic
987659610 5:20855271-20855293 GCCCATGAAGGGAACCAGAAAGG + Intergenic
988764034 5:34350376-34350398 GCCCATGAAGGGAACCAGAAAGG - Intergenic
989305299 5:39948319-39948341 CTCCCCGTAGGAAATCAGAAAGG + Intergenic
989711108 5:44398366-44398388 GCCCCCAAAGGAAAGAAGAAGGG - Intergenic
990107983 5:52288163-52288185 GTCCCTGAAGCAAACCTGAAAGG - Intergenic
993548996 5:89250230-89250252 GTTCCAGAAGGGAAGCAGAAAGG + Intergenic
994432051 5:99678654-99678676 GTCACCGAAGGACAGCAGAAAGG - Intergenic
995797446 5:115956859-115956881 GTCCCAGAAGTCAAACAGAAGGG + Intergenic
998194315 5:140054269-140054291 TTCCTGGAAGGAAGCCAGAATGG + Intergenic
999423316 5:151464078-151464100 AACTCCGAAAGAAACCAGAATGG - Intronic
1001599078 5:172917250-172917272 AACCCCAAAGGAAACCAGAGTGG - Intronic
1001884552 5:175277573-175277595 TTCCCCGAAGGAACTCAGCAAGG - Intergenic
1003955337 6:11159373-11159395 GGCATGGAAGGAAACCAGAATGG + Intergenic
1005725946 6:28648933-28648955 GGCACAGATGGAAACCAGAAGGG + Intergenic
1005887099 6:30105410-30105432 GTCACCACAGGAAATCAGAAAGG - Intronic
1007770198 6:44185999-44186021 GTCCCTGCCAGAAACCAGAAGGG - Intergenic
1008030410 6:46688172-46688194 GTCCACGAAGGACACCCGCAGGG - Exonic
1010120602 6:72371577-72371599 CTCTCCCAAGGACACCAGAAAGG + Intronic
1012301287 6:97591734-97591756 GTGCACTGAGGAAACCAGAAAGG + Intergenic
1013810064 6:114034753-114034775 GTCCCTGAAGCAAACAAAAAGGG - Intergenic
1017827615 6:158093687-158093709 GTCCCCAAAGGGAACCATAGTGG + Intronic
1019778913 7:2928476-2928498 GTCCTCGAAGCAACCCTGAAAGG - Intronic
1020898132 7:13968726-13968748 GTGCCAGAAGGAAAAGAGAAAGG - Intronic
1028962647 7:96766766-96766788 GTCCCAGAAGGAAGCCAATAGGG + Intergenic
1032494365 7:132349665-132349687 CTCCACGAAGGACATCAGAAGGG - Intronic
1036569257 8:9965452-9965474 GTTCCCGTAGGAAACCAGGAGGG - Intergenic
1037064062 8:14553929-14553951 GTCCCCAAGGAAAAGCAGAATGG + Intronic
1038489753 8:27962105-27962127 GACCCCGAATGAAGCCAGGAAGG + Intronic
1041621772 8:59978530-59978552 TTCCCAGAAGGAAATCAAAATGG + Intergenic
1042695078 8:71547359-71547381 CTCCCCGAAGGAAAACAAACCGG + Intronic
1047485088 8:125322546-125322568 ATCCCCTAAGGAAACTAGCAAGG + Intronic
1050289057 9:4134824-4134846 GTCCCCAAAGGAAAACAAGAAGG - Intronic
1052228848 9:26122787-26122809 GTCCCTTGAGGGAACCAGAACGG + Intergenic
1059122768 9:111657222-111657244 ACCCCCGAATGAAACCAGGAAGG - Intronic
1062138930 9:134944776-134944798 GTCCCAGAAGGAAGGCGGAAAGG - Intergenic
1062448011 9:136603880-136603902 GTCCCCAAAAGAAACCCAAATGG + Intergenic
1062647300 9:137555196-137555218 TTCCCACAAGGAAACCAGGAGGG - Exonic
1185777143 X:2812500-2812522 GTCCCCGAAGGAAACCAGAAAGG + Intronic
1193163633 X:78257434-78257456 GTTCCCTAAGTAAACCTGAAAGG - Intergenic
1201143755 Y:11050240-11050262 GTTCCTGAAGGAAATTAGAAGGG + Intergenic
1201292869 Y:12438951-12438973 GTCCCCGAAGGAAACCAGAAAGG - Intergenic
1201699752 Y:16867596-16867618 TTCCTTAAAGGAAACCAGAATGG + Intergenic