ID: 1201295281

View in Genome Browser
Species Human (GRCh38)
Location Y:12457027-12457049
Sequence GTATATGTGTATATACATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201295281_1201295285 30 Left 1201295281 Y:12457027-12457049 CCTAAATGTATATACACATATAC No data
Right 1201295285 Y:12457080-12457102 CAGTATGCATACATATATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201295281 Original CRISPR GTATATGTGTATATACATTT AGG (reversed) Intergenic
No off target data available for this crispr