ID: 1201297806

View in Genome Browser
Species Human (GRCh38)
Location Y:12479594-12479616
Sequence CAGCGCAACCACGTGGGCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201297806_1201297810 -6 Left 1201297806 Y:12479594-12479616 CCCATGCCCACGTGGTTGCGCTG No data
Right 1201297810 Y:12479611-12479633 GCGCTGTTGCTGTTTGTGCATGG No data
1201297806_1201297812 13 Left 1201297806 Y:12479594-12479616 CCCATGCCCACGTGGTTGCGCTG No data
Right 1201297812 Y:12479630-12479652 ATGGCAAGCAGAATCAGTAAGGG No data
1201297806_1201297811 12 Left 1201297806 Y:12479594-12479616 CCCATGCCCACGTGGTTGCGCTG No data
Right 1201297811 Y:12479629-12479651 CATGGCAAGCAGAATCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201297806 Original CRISPR CAGCGCAACCACGTGGGCAT GGG (reversed) Intergenic
No off target data available for this crispr