ID: 1201297810

View in Genome Browser
Species Human (GRCh38)
Location Y:12479611-12479633
Sequence GCGCTGTTGCTGTTTGTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201297801_1201297810 13 Left 1201297801 Y:12479575-12479597 CCAGCTTTCCGAGCTTTCCCCCA No data
Right 1201297810 Y:12479611-12479633 GCGCTGTTGCTGTTTGTGCATGG No data
1201297802_1201297810 5 Left 1201297802 Y:12479583-12479605 CCGAGCTTTCCCCCATGCCCACG No data
Right 1201297810 Y:12479611-12479633 GCGCTGTTGCTGTTTGTGCATGG No data
1201297806_1201297810 -6 Left 1201297806 Y:12479594-12479616 CCCATGCCCACGTGGTTGCGCTG No data
Right 1201297810 Y:12479611-12479633 GCGCTGTTGCTGTTTGTGCATGG No data
1201297804_1201297810 -4 Left 1201297804 Y:12479592-12479614 CCCCCATGCCCACGTGGTTGCGC No data
Right 1201297810 Y:12479611-12479633 GCGCTGTTGCTGTTTGTGCATGG No data
1201297800_1201297810 16 Left 1201297800 Y:12479572-12479594 CCACCAGCTTTCCGAGCTTTCCC No data
Right 1201297810 Y:12479611-12479633 GCGCTGTTGCTGTTTGTGCATGG No data
1201297805_1201297810 -5 Left 1201297805 Y:12479593-12479615 CCCCATGCCCACGTGGTTGCGCT No data
Right 1201297810 Y:12479611-12479633 GCGCTGTTGCTGTTTGTGCATGG No data
1201297807_1201297810 -7 Left 1201297807 Y:12479595-12479617 CCATGCCCACGTGGTTGCGCTGT No data
Right 1201297810 Y:12479611-12479633 GCGCTGTTGCTGTTTGTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201297810 Original CRISPR GCGCTGTTGCTGTTTGTGCA TGG Intergenic
No off target data available for this crispr