ID: 1201297811

View in Genome Browser
Species Human (GRCh38)
Location Y:12479629-12479651
Sequence CATGGCAAGCAGAATCAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201297809_1201297811 5 Left 1201297809 Y:12479601-12479623 CCACGTGGTTGCGCTGTTGCTGT No data
Right 1201297811 Y:12479629-12479651 CATGGCAAGCAGAATCAGTAAGG No data
1201297805_1201297811 13 Left 1201297805 Y:12479593-12479615 CCCCATGCCCACGTGGTTGCGCT No data
Right 1201297811 Y:12479629-12479651 CATGGCAAGCAGAATCAGTAAGG No data
1201297806_1201297811 12 Left 1201297806 Y:12479594-12479616 CCCATGCCCACGTGGTTGCGCTG No data
Right 1201297811 Y:12479629-12479651 CATGGCAAGCAGAATCAGTAAGG No data
1201297807_1201297811 11 Left 1201297807 Y:12479595-12479617 CCATGCCCACGTGGTTGCGCTGT No data
Right 1201297811 Y:12479629-12479651 CATGGCAAGCAGAATCAGTAAGG No data
1201297808_1201297811 6 Left 1201297808 Y:12479600-12479622 CCCACGTGGTTGCGCTGTTGCTG No data
Right 1201297811 Y:12479629-12479651 CATGGCAAGCAGAATCAGTAAGG No data
1201297804_1201297811 14 Left 1201297804 Y:12479592-12479614 CCCCCATGCCCACGTGGTTGCGC No data
Right 1201297811 Y:12479629-12479651 CATGGCAAGCAGAATCAGTAAGG No data
1201297802_1201297811 23 Left 1201297802 Y:12479583-12479605 CCGAGCTTTCCCCCATGCCCACG No data
Right 1201297811 Y:12479629-12479651 CATGGCAAGCAGAATCAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201297811 Original CRISPR CATGGCAAGCAGAATCAGTA AGG Intergenic
No off target data available for this crispr