ID: 1201297812

View in Genome Browser
Species Human (GRCh38)
Location Y:12479630-12479652
Sequence ATGGCAAGCAGAATCAGTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201297808_1201297812 7 Left 1201297808 Y:12479600-12479622 CCCACGTGGTTGCGCTGTTGCTG No data
Right 1201297812 Y:12479630-12479652 ATGGCAAGCAGAATCAGTAAGGG No data
1201297809_1201297812 6 Left 1201297809 Y:12479601-12479623 CCACGTGGTTGCGCTGTTGCTGT No data
Right 1201297812 Y:12479630-12479652 ATGGCAAGCAGAATCAGTAAGGG No data
1201297802_1201297812 24 Left 1201297802 Y:12479583-12479605 CCGAGCTTTCCCCCATGCCCACG No data
Right 1201297812 Y:12479630-12479652 ATGGCAAGCAGAATCAGTAAGGG No data
1201297804_1201297812 15 Left 1201297804 Y:12479592-12479614 CCCCCATGCCCACGTGGTTGCGC No data
Right 1201297812 Y:12479630-12479652 ATGGCAAGCAGAATCAGTAAGGG No data
1201297806_1201297812 13 Left 1201297806 Y:12479594-12479616 CCCATGCCCACGTGGTTGCGCTG No data
Right 1201297812 Y:12479630-12479652 ATGGCAAGCAGAATCAGTAAGGG No data
1201297805_1201297812 14 Left 1201297805 Y:12479593-12479615 CCCCATGCCCACGTGGTTGCGCT No data
Right 1201297812 Y:12479630-12479652 ATGGCAAGCAGAATCAGTAAGGG No data
1201297807_1201297812 12 Left 1201297807 Y:12479595-12479617 CCATGCCCACGTGGTTGCGCTGT No data
Right 1201297812 Y:12479630-12479652 ATGGCAAGCAGAATCAGTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201297812 Original CRISPR ATGGCAAGCAGAATCAGTAA GGG Intergenic
No off target data available for this crispr