ID: 1201297923

View in Genome Browser
Species Human (GRCh38)
Location Y:12480672-12480694
Sequence CAGTCACCCTTCAGTATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201297923_1201297924 20 Left 1201297923 Y:12480672-12480694 CCATGAATACTGAAGGGTGACTG No data
Right 1201297924 Y:12480715-12480737 GCCTGATGATACGAGCAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201297923 Original CRISPR CAGTCACCCTTCAGTATTCA TGG (reversed) Intergenic
No off target data available for this crispr