ID: 1201299542

View in Genome Browser
Species Human (GRCh38)
Location Y:12493955-12493977
Sequence TCCTCACGCTGCAATCCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201299542_1201299544 9 Left 1201299542 Y:12493955-12493977 CCATCAGGATTGCAGCGTGAGGA No data
Right 1201299544 Y:12493987-12494009 TTTATTCCAAGCTATTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201299542 Original CRISPR TCCTCACGCTGCAATCCTGA TGG (reversed) Intergenic