ID: 1201305005

View in Genome Browser
Species Human (GRCh38)
Location Y:12542489-12542511
Sequence CCCATGCTTGGGTCTCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201305005_1201305013 9 Left 1201305005 Y:12542489-12542511 CCTGAAGGAGACCCAAGCATGGG No data
Right 1201305013 Y:12542521-12542543 CCACTTCAAGTGCTATGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201305005 Original CRISPR CCCATGCTTGGGTCTCCTTC AGG (reversed) Intergenic