ID: 1201305369

View in Genome Browser
Species Human (GRCh38)
Location Y:12545481-12545503
Sequence GTAGCTGCTTAGCTGAGGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201305366_1201305369 -9 Left 1201305366 Y:12545467-12545489 CCAGAACATGCCTTGTAGCTGCT No data
Right 1201305369 Y:12545481-12545503 GTAGCTGCTTAGCTGAGGCAAGG No data
1201305365_1201305369 -1 Left 1201305365 Y:12545459-12545481 CCATAATTCCAGAACATGCCTTG No data
Right 1201305369 Y:12545481-12545503 GTAGCTGCTTAGCTGAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201305369 Original CRISPR GTAGCTGCTTAGCTGAGGCA AGG Intergenic
No off target data available for this crispr