ID: 1201306375

View in Genome Browser
Species Human (GRCh38)
Location Y:12554212-12554234
Sequence GCCCCCTGCTTACCAGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1201306373_1201306375 14 Left 1201306373 Y:12554175-12554197 CCTTCAAGTCATTTGTTTCTTTC 0: 2
1: 0
2: 7
3: 96
4: 897
Right 1201306375 Y:12554212-12554234 GCCCCCTGCTTACCAGAGACAGG No data
1201306372_1201306375 18 Left 1201306372 Y:12554171-12554193 CCTTCCTTCAAGTCATTTGTTTC 0: 2
1: 0
2: 1
3: 43
4: 375
Right 1201306375 Y:12554212-12554234 GCCCCCTGCTTACCAGAGACAGG No data
1201306370_1201306375 20 Left 1201306370 Y:12554169-12554191 CCCCTTCCTTCAAGTCATTTGTT No data
Right 1201306375 Y:12554212-12554234 GCCCCCTGCTTACCAGAGACAGG No data
1201306371_1201306375 19 Left 1201306371 Y:12554170-12554192 CCCTTCCTTCAAGTCATTTGTTT 0: 2
1: 0
2: 2
3: 61
4: 595
Right 1201306375 Y:12554212-12554234 GCCCCCTGCTTACCAGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1201306375 Original CRISPR GCCCCCTGCTTACCAGAGAC AGG Intergenic
No off target data available for this crispr